other:
Reverse Transcription:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-goat AF647 Jackson Immunoresearch Cat# 705-605-003; RRID:AB_2340436 Goat anti-mouse AF488 Jackson Immunoresearch Cat# 115-545-003; RRID:AB_2338840 Goat anti-rabbit AF594 Jackson Immunoresearch Cat# 111-585-003; RRID:AB_2338059 Biological Samples Human liver tissue Washington University in St. Louis NCT003701828 Chemicals, Peptides, and Recombinant Proteins Collagenase A Sigma Cat# C5138 DNase I Sigma Cat# 10104159001 Percoll Sigma Cat# GE17-0891-02 Zombie Aqua Biolegend Cat# 423101 Fc Block BD Biosciences Cat# 553143 D-(+)-Glucose Sigma Cat# G8270 Insulin Humulin Cat# HI-210 DMEM Sigma Cat# D5671 L-glutamine Sigma Cat# G7513 P/S GIBCO Cat# 15140-122 FBS Sigma Cat# F2442 MDH Abcepta Cat# SM1000a 10% Neutral buffered formalin Sigma Cat# HT5011-1CS Tissue-Tek O.C.T. .. Sakura Cat# 4583 Triton X-100 Sigma Cat# X100 Hoechst 33342 ThermoFisher Cat# 62249 Prolong Gold anti-fade reagent ThermoFisher Cat# P36934 Power SYBR green PCR Mastermix Applied Biosystems Cat# 4367660 Critical Commercial Assays SMARTer PCR cDNA synthesis kit Clontech Cat# 634926 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4374966 PureLink RNA Mini kit Invitrogen-ThermoFisher Cat# 12183018A RNEasy Micro kit QIAGEN Cat# 74004 Deposited Data scRNA seq GEO GEO: GSE162651 Bulk RNA seq GEO GEO: GSE163003 Experimental Models: Organisms/Strains Mouse C57BL/6j Jackson Laboratory Cat# 000664 Mouse Flt3-Cre;R26tdTomato Dr. Kory Lavine (Lavine et.al., 2014) N/A Mouse Ccr2-GFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Ccr2-RFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Cx3cr1-GFP Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse CD115-CreER;R26tdTomato Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse Clec4f-Cre Dr. Martin Guilliams (Bonnardel et al., 2019) N/A (Continued on next page) e2 Cell Reports 34, 108626, January 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides 36B4 For ATC CCT GAC GCA CCG CCG TGA IDT N/A 36B4 Rev TGC ATC TGC TTG GAG CCC ACG TT IDT N/A Adgre1 For CTT TGG CTA TGG GCT TCC AGT IDT N/A Adgre1 Rev GCA AGG AGG ACA GAG TTT ATC GTG IDT N/A Timd4 For CCG GTG ACT TTG CCT TGT CAT IDT N/A Timd4 Rev CTC TGC ATT GCA CTT GGA ATT G IDT N/A CCL2 For GGC TCA GCC AGA TGC AGTT AA IDT N/A CCL2 Rev CCT ACT CAT TGG GAT CAT CTT GCT IDT N/A Cidec For ATG GAC TAC GCC ATG AAG TCT IDT N/A Cidec Rev CGG TGC TAA CAC GAC AGG G IDT N/A Colla1 For GCT CCT CTT AGG GGC CAC T IDT N/A Colla1 Rev CCA CGT CTC ACC ATT GGG G IDT N/A Trem2 For CTG GAA CCG TCA CCA TCA CTC IDT N/A Trem2 Rev CGA AAC TCG ATG ACT CCT CGG IDT N/A Gpnmb For GCT GGT CTT CGG ATG AAA ATG A IDT N/A Gpnmb Rev CCA CAA AGG TGA TAT TGG AAC CC IDT N/A CD63 For AGA GAC CAG GTG AAG TCA GAG IDT N/A CD63 Rev AGT CTG TGT AGT TAG AAG CTC CA IDT N/A Software and Algorithms FlowJo v10.7.1 FlowJo https://www.flowjo.com/ GraphPad Prism 8 GraphPad https://www.graphpad.com/ ImageJ ImageJ https://imagej.nih.gov/ij/ Phantasus Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/phantasus/ Single cell explorer Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/shiny// single_cell_explorer/ R-package DESeq2 RDocumentation https://bioconductor.org/packages/ release/bioc/html/DESeq2.html R-package Seurat RDocumentation https://cran.r-project.org/web/packages/ Seurat/index.html Other High fat, high sucrose diet Research Diets Cat# D12492 FPC diet Envigo Cat# TD.190142 Cell Reports 34, 108626, January 12, 2021 e3
Polymerase Chain Reaction:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human brain tissue This paper N/A Mouse brain tissue This paper N/A Critical commercial assays TruSeq Stranded mRNA Sample Prep Kit Illumina Cat#20020595 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 PCR Barcoding Kit Oxford Nanopore Technology Cat#SQK-PCB109 Deposited data Raw Human Iso-Seq data This paper SRA: PRJNA664117 Raw Mouse Iso-Seq data This paper SRA: PRJNA663877 Visualization of detected full-length transcripts (Genome browser track hub) This paper http://genome.ucsc.edu/cgi-bin/ hgTracks?hubUrl=http://genome. exeter.ac.uk/hub/hub.txt Isoform Viewer Resource This paper http://genome.exeter.ac.uk/build/ index.html FANTOM5 CAGE database (Lizio et al., 2019) https://fantom.gsc.riken.jp/5/ Intropolis junction database Nellore et al., 2016 https://github.com/nellore/intropolis Human reference genome Release 38, GRCh38 GENCODE https://www.gencodegenes.org/human/ Mouse reference genome Release 22, GRCm38 GENCODE https://www.gencodegenes.org/ mouse/release_M22.html MS-based human adult and fetal proteomic dataset Kim et al., 2014 PXD000561 RNA-Seq Mouse Castanho et al., 2020 N/A RNA-Seq Fetal This Paper N/A PolyA motif list Elizabeth Tseng https://github.com/Magdoll/SQANTI2 Software and algorithms Iso-Seq3 Wang et al., 2016 https://github.com/PacificBiosciences/ IsoSeq Minimap2 Li, 2018 https://github.com/lh3/minimap2 Cupcake Elizabeth Tseng https://github.com/Magdoll/ cDNA_Cupcake SQANTI2 Tardaguila et al., 2018 https://github.com/Magdoll/SQANTI2 TAMA Kuo et al., 2017 https://github.com/GenomeRIK/tama SUPPA2 Trincado et al., 2018 https://github.com/comprna/SUPPA Pychopper/Pinfish Oxford Nanopore Technologies https://github.com/nanoporetech/ pipeline-pinfish-analysis CPAT Wang et al., 2013 https://github.com/liguowang/cpat MetaMorpheus Solntsev et al., 2018 https://github.com/smith-chem-wisc/ MetaMorpheus STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Stringtie Pertea et al., 2015 https://github.com/gpertea/stringtie Kallisto Bray et al., 2016 https://github.com/pachterlab/kallisto (Continued on next page) e1 Cell Reports 37, 110022, November 16, 2021 ..
Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Article Title: Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-goat AF647 Jackson Immunoresearch Cat# 705-605-003; RRID:AB_2340436 Goat anti-mouse AF488 Jackson Immunoresearch Cat# 115-545-003; RRID:AB_2338840 Goat anti-rabbit AF594 Jackson Immunoresearch Cat# 111-585-003; RRID:AB_2338059 Biological Samples Human liver tissue Washington University in St. Louis NCT003701828 Chemicals, Peptides, and Recombinant Proteins Collagenase A Sigma Cat# C5138 DNase I Sigma Cat# 10104159001 Percoll Sigma Cat# GE17-0891-02 Zombie Aqua Biolegend Cat# 423101 Fc Block BD Biosciences Cat# 553143 D-(+)-Glucose Sigma Cat# G8270 Insulin Humulin Cat# HI-210 DMEM Sigma Cat# D5671 L-glutamine Sigma Cat# G7513 P/S GIBCO Cat# 15140-122 FBS Sigma Cat# F2442 MDH Abcepta Cat# SM1000a 10% Neutral buffered formalin Sigma Cat# HT5011-1CS Tissue-Tek O.C.T. .. Sakura Cat# 4583 Triton X-100 Sigma Cat# X100 Hoechst 33342 ThermoFisher Cat# 62249 Prolong Gold anti-fade reagent ThermoFisher Cat# P36934 Power SYBR green PCR Mastermix Applied Biosystems Cat# 4367660 Critical Commercial Assays SMARTer PCR cDNA synthesis kit Clontech Cat# 634926 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4374966 PureLink RNA Mini kit Invitrogen-ThermoFisher Cat# 12183018A RNEasy Micro kit QIAGEN Cat# 74004 Deposited Data scRNA seq GEO GEO: GSE162651 Bulk RNA seq GEO GEO: GSE163003 Experimental Models: Organisms/Strains Mouse C57BL/6j Jackson Laboratory Cat# 000664 Mouse Flt3-Cre;R26tdTomato Dr. Kory Lavine (Lavine et.al., 2014) N/A Mouse Ccr2-GFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Ccr2-RFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Cx3cr1-GFP Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse CD115-CreER;R26tdTomato Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse Clec4f-Cre Dr. Martin Guilliams (Bonnardel et al., 2019) N/A (Continued on next page) e2 Cell Reports 34, 108626, January 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides 36B4 For ATC CCT GAC GCA CCG CCG TGA IDT N/A 36B4 Rev TGC ATC TGC TTG GAG CCC ACG TT IDT N/A Adgre1 For CTT TGG CTA TGG GCT TCC AGT IDT N/A Adgre1 Rev GCA AGG AGG ACA GAG TTT ATC GTG IDT N/A Timd4 For CCG GTG ACT TTG CCT TGT CAT IDT N/A Timd4 Rev CTC TGC ATT GCA CTT GGA ATT G IDT N/A CCL2 For GGC TCA GCC AGA TGC AGTT AA IDT N/A CCL2 Rev CCT ACT CAT TGG GAT CAT CTT GCT IDT N/A Cidec For ATG GAC TAC GCC ATG AAG TCT IDT N/A Cidec Rev CGG TGC TAA CAC GAC AGG G IDT N/A Colla1 For GCT CCT CTT AGG GGC CAC T IDT N/A Colla1 Rev CCA CGT CTC ACC ATT GGG G IDT N/A Trem2 For CTG GAA CCG TCA CCA TCA CTC IDT N/A Trem2 Rev CGA AAC TCG ATG ACT CCT CGG IDT N/A Gpnmb For GCT GGT CTT CGG ATG AAA ATG A IDT N/A Gpnmb Rev CCA CAA AGG TGA TAT TGG AAC CC IDT N/A CD63 For AGA GAC CAG GTG AAG TCA GAG IDT N/A CD63 Rev AGT CTG TGT AGT TAG AAG CTC CA IDT N/A Software and Algorithms FlowJo v10.7.1 FlowJo https://www.flowjo.com/ GraphPad Prism 8 GraphPad https://www.graphpad.com/ ImageJ ImageJ https://imagej.nih.gov/ij/ Phantasus Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/phantasus/ Single cell explorer Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/shiny// single_cell_explorer/ R-package DESeq2 RDocumentation https://bioconductor.org/packages/ release/bioc/html/DESeq2.html R-package Seurat RDocumentation https://cran.r-project.org/web/packages/ Seurat/index.html Other High fat, high sucrose diet Research Diets Cat# D12492 FPC diet Envigo Cat# TD.190142 Cell Reports 34, 108626, January 12, 2021 e3
Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
cDNA Synthesis:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human brain tissue This paper N/A Mouse brain tissue This paper N/A Critical commercial assays TruSeq Stranded mRNA Sample Prep Kit Illumina Cat#20020595 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 PCR Barcoding Kit Oxford Nanopore Technology Cat#SQK-PCB109 Deposited data Raw Human Iso-Seq data This paper SRA: PRJNA664117 Raw Mouse Iso-Seq data This paper SRA: PRJNA663877 Visualization of detected full-length transcripts (Genome browser track hub) This paper http://genome.ucsc.edu/cgi-bin/ hgTracks?hubUrl=http://genome. exeter.ac.uk/hub/hub.txt Isoform Viewer Resource This paper http://genome.exeter.ac.uk/build/ index.html FANTOM5 CAGE database (Lizio et al., 2019) https://fantom.gsc.riken.jp/5/ Intropolis junction database Nellore et al., 2016 https://github.com/nellore/intropolis Human reference genome Release 38, GRCh38 GENCODE https://www.gencodegenes.org/human/ Mouse reference genome Release 22, GRCm38 GENCODE https://www.gencodegenes.org/ mouse/release_M22.html MS-based human adult and fetal proteomic dataset Kim et al., 2014 PXD000561 RNA-Seq Mouse Castanho et al., 2020 N/A RNA-Seq Fetal This Paper N/A PolyA motif list Elizabeth Tseng https://github.com/Magdoll/SQANTI2 Software and algorithms Iso-Seq3 Wang et al., 2016 https://github.com/PacificBiosciences/ IsoSeq Minimap2 Li, 2018 https://github.com/lh3/minimap2 Cupcake Elizabeth Tseng https://github.com/Magdoll/ cDNA_Cupcake SQANTI2 Tardaguila et al., 2018 https://github.com/Magdoll/SQANTI2 TAMA Kuo et al., 2017 https://github.com/GenomeRIK/tama SUPPA2 Trincado et al., 2018 https://github.com/comprna/SUPPA Pychopper/Pinfish Oxford Nanopore Technologies https://github.com/nanoporetech/ pipeline-pinfish-analysis CPAT Wang et al., 2013 https://github.com/liguowang/cpat MetaMorpheus Solntsev et al., 2018 https://github.com/smith-chem-wisc/ MetaMorpheus STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Stringtie Pertea et al., 2015 https://github.com/gpertea/stringtie Kallisto Bray et al., 2016 https://github.com/pachterlab/kallisto (Continued on next page) e1 Cell Reports 37, 110022, November 16, 2021 ..
Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Article Title: Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-goat AF647 Jackson Immunoresearch Cat# 705-605-003; RRID:AB_2340436 Goat anti-mouse AF488 Jackson Immunoresearch Cat# 115-545-003; RRID:AB_2338840 Goat anti-rabbit AF594 Jackson Immunoresearch Cat# 111-585-003; RRID:AB_2338059 Biological Samples Human liver tissue Washington University in St. Louis NCT003701828 Chemicals, Peptides, and Recombinant Proteins Collagenase A Sigma Cat# C5138 DNase I Sigma Cat# 10104159001 Percoll Sigma Cat# GE17-0891-02 Zombie Aqua Biolegend Cat# 423101 Fc Block BD Biosciences Cat# 553143 D-(+)-Glucose Sigma Cat# G8270 Insulin Humulin Cat# HI-210 DMEM Sigma Cat# D5671 L-glutamine Sigma Cat# G7513 P/S GIBCO Cat# 15140-122 FBS Sigma Cat# F2442 MDH Abcepta Cat# SM1000a 10% Neutral buffered formalin Sigma Cat# HT5011-1CS Tissue-Tek O.C.T. .. Sakura Cat# 4583 Triton X-100 Sigma Cat# X100 Hoechst 33342 ThermoFisher Cat# 62249 Prolong Gold anti-fade reagent ThermoFisher Cat# P36934 Power SYBR green PCR Mastermix Applied Biosystems Cat# 4367660 Critical Commercial Assays SMARTer PCR cDNA synthesis kit Clontech Cat# 634926 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4374966 PureLink RNA Mini kit Invitrogen-ThermoFisher Cat# 12183018A RNEasy Micro kit QIAGEN Cat# 74004 Deposited Data scRNA seq GEO GEO: GSE162651 Bulk RNA seq GEO GEO: GSE163003 Experimental Models: Organisms/Strains Mouse C57BL/6j Jackson Laboratory Cat# 000664 Mouse Flt3-Cre;R26tdTomato Dr. Kory Lavine (Lavine et.al., 2014) N/A Mouse Ccr2-GFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Ccr2-RFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Cx3cr1-GFP Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse CD115-CreER;R26tdTomato Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse Clec4f-Cre Dr. Martin Guilliams (Bonnardel et al., 2019) N/A (Continued on next page) e2 Cell Reports 34, 108626, January 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides 36B4 For ATC CCT GAC GCA CCG CCG TGA IDT N/A 36B4 Rev TGC ATC TGC TTG GAG CCC ACG TT IDT N/A Adgre1 For CTT TGG CTA TGG GCT TCC AGT IDT N/A Adgre1 Rev GCA AGG AGG ACA GAG TTT ATC GTG IDT N/A Timd4 For CCG GTG ACT TTG CCT TGT CAT IDT N/A Timd4 Rev CTC TGC ATT GCA CTT GGA ATT G IDT N/A CCL2 For GGC TCA GCC AGA TGC AGTT AA IDT N/A CCL2 Rev CCT ACT CAT TGG GAT CAT CTT GCT IDT N/A Cidec For ATG GAC TAC GCC ATG AAG TCT IDT N/A Cidec Rev CGG TGC TAA CAC GAC AGG G IDT N/A Colla1 For GCT CCT CTT AGG GGC CAC T IDT N/A Colla1 Rev CCA CGT CTC ACC ATT GGG G IDT N/A Trem2 For CTG GAA CCG TCA CCA TCA CTC IDT N/A Trem2 Rev CGA AAC TCG ATG ACT CCT CGG IDT N/A Gpnmb For GCT GGT CTT CGG ATG AAA ATG A IDT N/A Gpnmb Rev CCA CAA AGG TGA TAT TGG AAC CC IDT N/A CD63 For AGA GAC CAG GTG AAG TCA GAG IDT N/A CD63 Rev AGT CTG TGT AGT TAG AAG CTC CA IDT N/A Software and Algorithms FlowJo v10.7.1 FlowJo https://www.flowjo.com/ GraphPad Prism 8 GraphPad https://www.graphpad.com/ ImageJ ImageJ https://imagej.nih.gov/ij/ Phantasus Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/phantasus/ Single cell explorer Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/shiny// single_cell_explorer/ R-package DESeq2 RDocumentation https://bioconductor.org/packages/ release/bioc/html/DESeq2.html R-package Seurat RDocumentation https://cran.r-project.org/web/packages/ Seurat/index.html Other High fat, high sucrose diet Research Diets Cat# D12492 FPC diet Envigo Cat# TD.190142 Cell Reports 34, 108626, January 12, 2021 e3
Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
SYBR Green Assay:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-goat AF647 Jackson Immunoresearch Cat# 705-605-003; RRID:AB_2340436 Goat anti-mouse AF488 Jackson Immunoresearch Cat# 115-545-003; RRID:AB_2338840 Goat anti-rabbit AF594 Jackson Immunoresearch Cat# 111-585-003; RRID:AB_2338059 Biological Samples Human liver tissue Washington University in St. Louis NCT003701828 Chemicals, Peptides, and Recombinant Proteins Collagenase A Sigma Cat# C5138 DNase I Sigma Cat# 10104159001 Percoll Sigma Cat# GE17-0891-02 Zombie Aqua Biolegend Cat# 423101 Fc Block BD Biosciences Cat# 553143 D-(+)-Glucose Sigma Cat# G8270 Insulin Humulin Cat# HI-210 DMEM Sigma Cat# D5671 L-glutamine Sigma Cat# G7513 P/S GIBCO Cat# 15140-122 FBS Sigma Cat# F2442 MDH Abcepta Cat# SM1000a 10% Neutral buffered formalin Sigma Cat# HT5011-1CS Tissue-Tek O.C.T. .. Sakura Cat# 4583 Triton X-100 Sigma Cat# X100 Hoechst 33342 ThermoFisher Cat# 62249 Prolong Gold anti-fade reagent ThermoFisher Cat# P36934 Power SYBR green PCR Mastermix Applied Biosystems Cat# 4367660 Critical Commercial Assays SMARTer PCR cDNA synthesis kit Clontech Cat# 634926 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4374966 PureLink RNA Mini kit Invitrogen-ThermoFisher Cat# 12183018A RNEasy Micro kit QIAGEN Cat# 74004 Deposited Data scRNA seq GEO GEO: GSE162651 Bulk RNA seq GEO GEO: GSE163003 Experimental Models: Organisms/Strains Mouse C57BL/6j Jackson Laboratory Cat# 000664 Mouse Flt3-Cre;R26tdTomato Dr. Kory Lavine (Lavine et.al., 2014) N/A Mouse Ccr2-GFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Ccr2-RFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Cx3cr1-GFP Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse CD115-CreER;R26tdTomato Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse Clec4f-Cre Dr. Martin Guilliams (Bonnardel et al., 2019) N/A (Continued on next page) e2 Cell Reports 34, 108626, January 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides 36B4 For ATC CCT GAC GCA CCG CCG TGA IDT N/A 36B4 Rev TGC ATC TGC TTG GAG CCC ACG TT IDT N/A Adgre1 For CTT TGG CTA TGG GCT TCC AGT IDT N/A Adgre1 Rev GCA AGG AGG ACA GAG TTT ATC GTG IDT N/A Timd4 For CCG GTG ACT TTG CCT TGT CAT IDT N/A Timd4 Rev CTC TGC ATT GCA CTT GGA ATT G IDT N/A CCL2 For GGC TCA GCC AGA TGC AGTT AA IDT N/A CCL2 Rev CCT ACT CAT TGG GAT CAT CTT GCT IDT N/A Cidec For ATG GAC TAC GCC ATG AAG TCT IDT N/A Cidec Rev CGG TGC TAA CAC GAC AGG G IDT N/A Colla1 For GCT CCT CTT AGG GGC CAC T IDT N/A Colla1 Rev CCA CGT CTC ACC ATT GGG G IDT N/A Trem2 For CTG GAA CCG TCA CCA TCA CTC IDT N/A Trem2 Rev CGA AAC TCG ATG ACT CCT CGG IDT N/A Gpnmb For GCT GGT CTT CGG ATG AAA ATG A IDT N/A Gpnmb Rev CCA CAA AGG TGA TAT TGG AAC CC IDT N/A CD63 For AGA GAC CAG GTG AAG TCA GAG IDT N/A CD63 Rev AGT CTG TGT AGT TAG AAG CTC CA IDT N/A Software and Algorithms FlowJo v10.7.1 FlowJo https://www.flowjo.com/ GraphPad Prism 8 GraphPad https://www.graphpad.com/ ImageJ ImageJ https://imagej.nih.gov/ij/ Phantasus Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/phantasus/ Single cell explorer Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/shiny// single_cell_explorer/ R-package DESeq2 RDocumentation https://bioconductor.org/packages/ release/bioc/html/DESeq2.html R-package Seurat RDocumentation https://cran.r-project.org/web/packages/ Seurat/index.html Other High fat, high sucrose diet Research Diets Cat# D12492 FPC diet Envigo Cat# TD.190142 Cell Reports 34, 108626, January 12, 2021 e3
Real-time Polymerase Chain Reaction:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
RNAscope:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Multiplex Assay:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Single Cell:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Sequencing:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
Software:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Article Title: Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human brain tissue This paper N/A Mouse brain tissue This paper N/A Critical commercial assays TruSeq Stranded mRNA Sample Prep Kit Illumina Cat#20020595 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 PCR Barcoding Kit Oxford Nanopore Technology Cat#SQK-PCB109 Deposited data Raw Human Iso-Seq data This paper SRA: PRJNA664117 Raw Mouse Iso-Seq data This paper SRA: PRJNA663877 Visualization of detected full-length transcripts (Genome browser track hub) This paper http://genome.ucsc.edu/cgi-bin/ hgTracks?hubUrl=http://genome. exeter.ac.uk/hub/hub.txt Isoform Viewer Resource This paper http://genome.exeter.ac.uk/build/ index.html FANTOM5 CAGE database (Lizio et al., 2019) https://fantom.gsc.riken.jp/5/ Intropolis junction database Nellore et al., 2016 https://github.com/nellore/intropolis Human reference genome Release 38, GRCh38 GENCODE https://www.gencodegenes.org/human/ Mouse reference genome Release 22, GRCm38 GENCODE https://www.gencodegenes.org/ mouse/release_M22.html MS-based human adult and fetal proteomic dataset Kim et al., 2014 PXD000561 RNA-Seq Mouse Castanho et al., 2020 N/A RNA-Seq Fetal This Paper N/A PolyA motif list Elizabeth Tseng https://github.com/Magdoll/SQANTI2 Software and algorithms Iso-Seq3 Wang et al., 2016 https://github.com/PacificBiosciences/ IsoSeq Minimap2 Li, 2018 https://github.com/lh3/minimap2 Cupcake Elizabeth Tseng https://github.com/Magdoll/ cDNA_Cupcake SQANTI2 Tardaguila et al., 2018 https://github.com/Magdoll/SQANTI2 TAMA Kuo et al., 2017 https://github.com/GenomeRIK/tama SUPPA2 Trincado et al., 2018 https://github.com/comprna/SUPPA Pychopper/Pinfish Oxford Nanopore Technologies https://github.com/nanoporetech/ pipeline-pinfish-analysis CPAT Wang et al., 2013 https://github.com/liguowang/cpat MetaMorpheus Solntsev et al., 2018 https://github.com/smith-chem-wisc/ MetaMorpheus STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Stringtie Pertea et al., 2015 https://github.com/gpertea/stringtie Kallisto Bray et al., 2016 https://github.com/pachterlab/kallisto (Continued on next page) e1 Cell Reports 37, 110022, November 16, 2021 ..
Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Microscopy:Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNeasy Mini kit Qiagen Cat#74104 Surperscript IV Reverse transcriptase Invitrogen Cat#18090010 Smarter PCR cDNA synthesis kit Clontech Cat634925 Advantage 2 PCR kit Clontech Cat#639206 SYBR Green Real-time PCR Master Mix Toyobo Cat#PK-201 RNAscope Multiplex FluorescentReagent Kit v2 Assay Advanced Cell Diagnostic Cat#323110 Chromium Single Cell 3′ Reagent Kit v3 10× Genomics Cat#1000092 Chromium Single Cell 3′ Reagent Kit v3.1 10× Genomics Cat#1000269 Deposited data Raw scRNA-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw MERSCOPE dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Raw AcRetro-seq dataset This paper https://doi.org/10.12412/ BSDC.1763109908.20001 Single nucleus sequencing data from mouse spinal cord Russ et al.21 http://www.seqseek.ninds.nih.gov/ Experimental models: Organisms/strains Mouse: C57BL/6N SLAC laboratory N/A Mouse: LSL-H2B-GFP The Jackson Laboratory JAX036761 Mouse: Vglut2-Cre The Jackson Laboratory JAX016963 Mouse: Vgat-Cre The Jackson Laboratory JAX016962 Mouse: Pvalb-Cre The Jackson Laboratory JAX008069 Mouse: Nmur2-Cre Xu et al.82 N/A Mouse: Sncg-Cre This paper N/A Mouse: Qrfpr-Cre This paper N/A Software and algorithms Qupath, version 0.3.0 Bankhead et al.83 N/A Fiji-ImageJ National Institute of Health https://imagej.net/Fiji; RRID: SCR_003070 GraphPad Prism 8 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 Seurat (v4.3.0) Satija Lab https://satijalab.org/seurat/ Fast Neurite Tracer (FNT) Gao et al.49 N/A Amira (v.5.2.2) FEI, Mérignac Cedex, France RRID: SCR_007353 Other FV3000 confocal microscope Olympus N/A VS-120 microscope Olympus N/A Cell Reports 45, 116717, January 27, 2026 19 .. Surgical procedures of stereotaxic injection Mice were anesthetized with Zoletil (Tiletamine hydrochloride: 15 mg/kg; Zalazepam hydrochloride: 15 mg/kg; Virbac S.A) and Xylazine hydrochloride (80 mg/kg, Huamu Veterinary Medicine) and mounted in a stereotaxic apparatus.
Sample Prep:Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human brain tissue This paper N/A Mouse brain tissue This paper N/A Critical commercial assays TruSeq Stranded mRNA Sample Prep Kit Illumina Cat#20020595 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 PCR Barcoding Kit Oxford Nanopore Technology Cat#SQK-PCB109 Deposited data Raw Human Iso-Seq data This paper SRA: PRJNA664117 Raw Mouse Iso-Seq data This paper SRA: PRJNA663877 Visualization of detected full-length transcripts (Genome browser track hub) This paper http://genome.ucsc.edu/cgi-bin/ hgTracks?hubUrl=http://genome. exeter.ac.uk/hub/hub.txt Isoform Viewer Resource This paper http://genome.exeter.ac.uk/build/ index.html FANTOM5 CAGE database (Lizio et al., 2019) https://fantom.gsc.riken.jp/5/ Intropolis junction database Nellore et al., 2016 https://github.com/nellore/intropolis Human reference genome Release 38, GRCh38 GENCODE https://www.gencodegenes.org/human/ Mouse reference genome Release 22, GRCm38 GENCODE https://www.gencodegenes.org/ mouse/release_M22.html MS-based human adult and fetal proteomic dataset Kim et al., 2014 PXD000561 RNA-Seq Mouse Castanho et al., 2020 N/A RNA-Seq Fetal This Paper N/A PolyA motif list Elizabeth Tseng https://github.com/Magdoll/SQANTI2 Software and algorithms Iso-Seq3 Wang et al., 2016 https://github.com/PacificBiosciences/ IsoSeq Minimap2 Li, 2018 https://github.com/lh3/minimap2 Cupcake Elizabeth Tseng https://github.com/Magdoll/ cDNA_Cupcake SQANTI2 Tardaguila et al., 2018 https://github.com/Magdoll/SQANTI2 TAMA Kuo et al., 2017 https://github.com/GenomeRIK/tama SUPPA2 Trincado et al., 2018 https://github.com/comprna/SUPPA Pychopper/Pinfish Oxford Nanopore Technologies https://github.com/nanoporetech/ pipeline-pinfish-analysis CPAT Wang et al., 2013 https://github.com/liguowang/cpat MetaMorpheus Solntsev et al., 2018 https://github.com/smith-chem-wisc/ MetaMorpheus STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Stringtie Pertea et al., 2015 https://github.com/gpertea/stringtie Kallisto Bray et al., 2016 https://github.com/pachterlab/kallisto (Continued on next page) e1 Cell Reports 37, 110022, November 16, 2021 ..
Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Binding Assay:Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human brain tissue This paper N/A Mouse brain tissue This paper N/A Critical commercial assays TruSeq Stranded mRNA Sample Prep Kit Illumina Cat#20020595 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 PCR Barcoding Kit Oxford Nanopore Technology Cat#SQK-PCB109 Deposited data Raw Human Iso-Seq data This paper SRA: PRJNA664117 Raw Mouse Iso-Seq data This paper SRA: PRJNA663877 Visualization of detected full-length transcripts (Genome browser track hub) This paper http://genome.ucsc.edu/cgi-bin/ hgTracks?hubUrl=http://genome. exeter.ac.uk/hub/hub.txt Isoform Viewer Resource This paper http://genome.exeter.ac.uk/build/ index.html FANTOM5 CAGE database (Lizio et al., 2019) https://fantom.gsc.riken.jp/5/ Intropolis junction database Nellore et al., 2016 https://github.com/nellore/intropolis Human reference genome Release 38, GRCh38 GENCODE https://www.gencodegenes.org/human/ Mouse reference genome Release 22, GRCm38 GENCODE https://www.gencodegenes.org/ mouse/release_M22.html MS-based human adult and fetal proteomic dataset Kim et al., 2014 PXD000561 RNA-Seq Mouse Castanho et al., 2020 N/A RNA-Seq Fetal This Paper N/A PolyA motif list Elizabeth Tseng https://github.com/Magdoll/SQANTI2 Software and algorithms Iso-Seq3 Wang et al., 2016 https://github.com/PacificBiosciences/ IsoSeq Minimap2 Li, 2018 https://github.com/lh3/minimap2 Cupcake Elizabeth Tseng https://github.com/Magdoll/ cDNA_Cupcake SQANTI2 Tardaguila et al., 2018 https://github.com/Magdoll/SQANTI2 TAMA Kuo et al., 2017 https://github.com/GenomeRIK/tama SUPPA2 Trincado et al., 2018 https://github.com/comprna/SUPPA Pychopper/Pinfish Oxford Nanopore Technologies https://github.com/nanoporetech/ pipeline-pinfish-analysis CPAT Wang et al., 2013 https://github.com/liguowang/cpat MetaMorpheus Solntsev et al., 2018 https://github.com/smith-chem-wisc/ MetaMorpheus STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Stringtie Pertea et al., 2015 https://github.com/gpertea/stringtie Kallisto Bray et al., 2016 https://github.com/pachterlab/kallisto (Continued on next page) e1 Cell Reports 37, 110022, November 16, 2021 ..
Staining:Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Hi-C:Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
DNA Sequencing:Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
RNA sequencing:Article Title: A chromosome-level genome of the human blood fluke Schistosoma japonicum identifies the genomic basis of host-switching.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy Blood & Tissue Kit (250) QIAGEN Cat#69506 Qubit dsDNA HS Assay Kit Life Technologies Cat#Q32854 TruSeq RNA Sample Preparation kit Illumina Cat#FC-122-1001 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 TruSeq DNA HT Sample Prep Kit Illumina Cat#FC-121-2003 AMPure PB Beads Pacific Biosciences Cat#100-265-900 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Scientific Cat#65001 TruSeq RNA Library Prep Kit v2 Illumina Cat#RS-122-2001 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences Cat#100-938-900 GelRed Nucleic Acid Gel Stain 10,000X in water Biotium Cat#41003 1kb DNA Ladder New England Biolabs Cat#N3232L Trizol reagent Thermo Fisher Scientific Cat#15596026 Formaldehyde solution Sigma Cat#252549 HieffTM qPCR SYBR Green Master Mix (No Rox) YEASEN Cat#11201ES03 23HieffTM PCR Master Mix (With Dye) YEASEN Cat#10102ES60 HifairTM III 1st Strand cDNA Synthesis SuperMix for qPCR YEASEN Cat#11141ES60 MEGAscriptTM T7 Transcription Kit Thermo Fisher Scientific Cat#AM1333 Fetal Bovine Serum TOCYTO Cat#UT81304 AG RNAex Pro Reagent Accurate Biology Cat#AG21101 Deposited data Hi-C Sequence data This paper SRA: SRR14878343 PacBio Sequence data This paper SRA: SRR14878347 DNA-Seq data This paper SRA: SRR14878346 Iso-Seq data This paper SRA: SRR14878345 RNA-Seq data This paper SRA: SRR14878344 DNA-Seq of 72 samples This paper NCBI: PRJNA789681 Schistosoma japonicum genome (SjV3) This paper NCBI: JAHRBV000000000 Schistosoma mansoni genome reference (V9) (Buddenborg et al., 2021) 10.5281/zenodo.5149023 Schistosoma japonicum genome (SjV2) (Luo et al., 2019) NCBI: GCA_006368765.1 DNA-Seq of S. mansoni (Crellen et al., 2016) SRA: ERP000385 DNA-Seq of female S. japonicum (Picard et al., 2018) SRA: SRR6841388 DNA-Seq of male S. japonicum (Picard et al., 2018) SRA: SRR6841389 Experimental models: Organisms/strains Mouse: Kunming Jsj-lab N/A Schistosoma japonicum This paper N/A Oligonucleotides qPCR primer GATAD2A-R1 CTAAGAGGCTGCTCATTAACA Tsingke N/A qPCR Primer GATAD2A-F1 CCAACAACCACACCACAC Tsingke N/A dsRNA primer GATAD2A-R1 CTAGTTGAACGGATCCATC Tsingke N/A dsRNA primer GATAD2A-F1 GTCAGTGGAGAGGGTGAAG Tsingke N/A qPCR primer PSMD-R1 TTGCGAACATCTTCATTCTG Tsingke N/A (Continued on next page) Cell Reports 39, 110638, April 5, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SMC++ (Terhorst et al., 2017) https://github.com/popgenmethods/smcpp PLINK (version 1.9) (Purcell et al., 2007) https://www.cog-genomics.org/plink/; RRID: SCR_001757 Beagle (version 5.0) (Browning and Browning, 2007) https://faculty.washington.edu/browning/ beagle/b5_0.html; RRID: SCR_001789 SAMtools (version 1.12) (Li and Durbin, 2009) https://sourceforge.net/projects/samtools/ files/samtools/1.12/; RRID: SCR_002105 AncestryPainter (Feng et al., 2018) https://github.com/Shuhua-Group/ AncestryPainter R R Core Team https://www.r-project.org/; RRID: SCR_001905 PSMC (Nadachowska-Brzyska et al., 2016) https://github.com/lh3/psmc; RRID: SCR_017229
Article Title: Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human brain tissue This paper N/A Mouse brain tissue This paper N/A Critical commercial assays TruSeq Stranded mRNA Sample Prep Kit Illumina Cat#20020595 SMARTer PCR cDNA Synthesis Kit Clontech Cat634925 SMRTbell Template Prep Kit Pacific Biosciences Cat#100-222-300 Sequel Binding Kit Pacific Biosciences Cat#101-029-000 PCR Barcoding Kit Oxford Nanopore Technology Cat#SQK-PCB109 Deposited data Raw Human Iso-Seq data This paper SRA: PRJNA664117 Raw Mouse Iso-Seq data This paper SRA: PRJNA663877 Visualization of detected full-length transcripts (Genome browser track hub) This paper http://genome.ucsc.edu/cgi-bin/ hgTracks?hubUrl=http://genome. exeter.ac.uk/hub/hub.txt Isoform Viewer Resource This paper http://genome.exeter.ac.uk/build/ index.html FANTOM5 CAGE database (Lizio et al., 2019) https://fantom.gsc.riken.jp/5/ Intropolis junction database Nellore et al., 2016 https://github.com/nellore/intropolis Human reference genome Release 38, GRCh38 GENCODE https://www.gencodegenes.org/human/ Mouse reference genome Release 22, GRCm38 GENCODE https://www.gencodegenes.org/ mouse/release_M22.html MS-based human adult and fetal proteomic dataset Kim et al., 2014 PXD000561 RNA-Seq Mouse Castanho et al., 2020 N/A RNA-Seq Fetal This Paper N/A PolyA motif list Elizabeth Tseng https://github.com/Magdoll/SQANTI2 Software and algorithms Iso-Seq3 Wang et al., 2016 https://github.com/PacificBiosciences/ IsoSeq Minimap2 Li, 2018 https://github.com/lh3/minimap2 Cupcake Elizabeth Tseng https://github.com/Magdoll/ cDNA_Cupcake SQANTI2 Tardaguila et al., 2018 https://github.com/Magdoll/SQANTI2 TAMA Kuo et al., 2017 https://github.com/GenomeRIK/tama SUPPA2 Trincado et al., 2018 https://github.com/comprna/SUPPA Pychopper/Pinfish Oxford Nanopore Technologies https://github.com/nanoporetech/ pipeline-pinfish-analysis CPAT Wang et al., 2013 https://github.com/liguowang/cpat MetaMorpheus Solntsev et al., 2018 https://github.com/smith-chem-wisc/ MetaMorpheus STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Stringtie Pertea et al., 2015 https://github.com/gpertea/stringtie Kallisto Bray et al., 2016 https://github.com/pachterlab/kallisto (Continued on next page) e1 Cell Reports 37, 110022, November 16, 2021 ..
Recombinant:Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
Purification:Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
RNA Sequencing:Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
Article Title: Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-goat AF647 Jackson Immunoresearch Cat# 705-605-003; RRID:AB_2340436 Goat anti-mouse AF488 Jackson Immunoresearch Cat# 115-545-003; RRID:AB_2338840 Goat anti-rabbit AF594 Jackson Immunoresearch Cat# 111-585-003; RRID:AB_2338059 Biological Samples Human liver tissue Washington University in St. Louis NCT003701828 Chemicals, Peptides, and Recombinant Proteins Collagenase A Sigma Cat# C5138 DNase I Sigma Cat# 10104159001 Percoll Sigma Cat# GE17-0891-02 Zombie Aqua Biolegend Cat# 423101 Fc Block BD Biosciences Cat# 553143 D-(+)-Glucose Sigma Cat# G8270 Insulin Humulin Cat# HI-210 DMEM Sigma Cat# D5671 L-glutamine Sigma Cat# G7513 P/S GIBCO Cat# 15140-122 FBS Sigma Cat# F2442 MDH Abcepta Cat# SM1000a 10% Neutral buffered formalin Sigma Cat# HT5011-1CS Tissue-Tek O.C.T. .. Sakura Cat# 4583 Triton X-100 Sigma Cat# X100 Hoechst 33342 ThermoFisher Cat# 62249 Prolong Gold anti-fade reagent ThermoFisher Cat# P36934 Power SYBR green PCR Mastermix Applied Biosystems Cat# 4367660 Critical Commercial Assays SMARTer PCR cDNA synthesis kit Clontech Cat# 634926 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4374966 PureLink RNA Mini kit Invitrogen-ThermoFisher Cat# 12183018A RNEasy Micro kit QIAGEN Cat# 74004 Deposited Data scRNA seq GEO GEO: GSE162651 Bulk RNA seq GEO GEO: GSE163003 Experimental Models: Organisms/Strains Mouse C57BL/6j Jackson Laboratory Cat# 000664 Mouse Flt3-Cre;R26tdTomato Dr. Kory Lavine (Lavine et.al., 2014) N/A Mouse Ccr2-GFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Ccr2-RFP Dr. Kory Lavine, Washington University School of Medicine N/A Mouse Cx3cr1-GFP Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse CD115-CreER;R26tdTomato Dr. Gwendolyn Randolph, Washington University School of Medicine N/A Mouse Clec4f-Cre Dr. Martin Guilliams (Bonnardel et al., 2019) N/A (Continued on next page) e2 Cell Reports 34, 108626, January 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides 36B4 For ATC CCT GAC GCA CCG CCG TGA IDT N/A 36B4 Rev TGC ATC TGC TTG GAG CCC ACG TT IDT N/A Adgre1 For CTT TGG CTA TGG GCT TCC AGT IDT N/A Adgre1 Rev GCA AGG AGG ACA GAG TTT ATC GTG IDT N/A Timd4 For CCG GTG ACT TTG CCT TGT CAT IDT N/A Timd4 Rev CTC TGC ATT GCA CTT GGA ATT G IDT N/A CCL2 For GGC TCA GCC AGA TGC AGTT AA IDT N/A CCL2 Rev CCT ACT CAT TGG GAT CAT CTT GCT IDT N/A Cidec For ATG GAC TAC GCC ATG AAG TCT IDT N/A Cidec Rev CGG TGC TAA CAC GAC AGG G IDT N/A Colla1 For GCT CCT CTT AGG GGC CAC T IDT N/A Colla1 Rev CCA CGT CTC ACC ATT GGG G IDT N/A Trem2 For CTG GAA CCG TCA CCA TCA CTC IDT N/A Trem2 Rev CGA AAC TCG ATG ACT CCT CGG IDT N/A Gpnmb For GCT GGT CTT CGG ATG AAA ATG A IDT N/A Gpnmb Rev CCA CAA AGG TGA TAT TGG AAC CC IDT N/A CD63 For AGA GAC CAG GTG AAG TCA GAG IDT N/A CD63 Rev AGT CTG TGT AGT TAG AAG CTC CA IDT N/A Software and Algorithms FlowJo v10.7.1 FlowJo https://www.flowjo.com/ GraphPad Prism 8 GraphPad https://www.graphpad.com/ ImageJ ImageJ https://imagej.nih.gov/ij/ Phantasus Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/phantasus/ Single cell explorer Artyomov Lab, Washington University in St. Louis https://artyomovlab.wustl.edu/shiny// single_cell_explorer/ R-package DESeq2 RDocumentation https://bioconductor.org/packages/ release/bioc/html/DESeq2.html R-package Seurat RDocumentation https://cran.r-project.org/web/packages/ Seurat/index.html Other High fat, high sucrose diet Research Diets Cat# D12492 FPC diet Envigo Cat# TD.190142 Cell Reports 34, 108626, January 12, 2021 e3
Expressing:Article Title: Tumor evolution of glioma intrinsic gene expression subtype associates with immunological changes in the microenvironment
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Anti-AIF1 Abcam Cat#:ab178846 Mouse monoclonal anti-GFAP (GA5) Cell Signaling Technology Cat# 3670 RRID:AB_10831828 Mouse monoclonal Anti-beta-Tubulin Cell Signaling Technology Cat# 2128, RRID:AB_823664) Mouse monoclonal Anti-Vinculin EMD Millipore Cat# 05-386, RRID:AB_309711 Mouse monoclonal anti-NF1 (McNFn27b) GeneTex Cat#:GTX15776 Rabbit polyclonal anti-ITGAM Sigma-Aldrich Cat# HPA002274 RRID:AB_1078435 Mouse monoclonal Anti-Bovine alpha-Actinin Sigma-Aldrich Cat# A5044 RRID:AB_476737 Rabbit polyclonal Anti-Iba-1 Wako Cat# 016-20001 RRID:AB_839506 Chemicals, Peptides, and Recombinant Proteins EGF Sigma-Aldrich Cat#: E9644 bFGF Sigma-Aldrich Cat# F0291 Calcein AM BD Biosciences Cat#564061 Critical Commercial Assays RNA Truseq library prep kit Illumina Cat #.15042173 MasterPureTM Complete DNA and RNA Purification Kit Epicenter Cat# MC85200 BD FluoroBlokTM System BD Biosciences Cat# {"type":"entrez-nucleotide","attrs":{"text":"BD351161","term_id":"92252298","term_text":"BD351161"}} BD351161 MACH 2 Double Stain 2 Biocare Medical Cat# MRCT525G SMARTer® PCR cDNA Synthesis Kit Clontech Cat# 634926 Nextera XT DNA Sample Prep Kit Illumina Cat#FC-131-1096 Deposited Data RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001001033 RNA sequencing data European Genome-phenome Archive (EGA) EGAS00001002429 Software and Algorithms InForm software Pannoramic Viewer Integrative Genomics Viewer (IGV, Version2.3) R package (Version 3.2.5) Open in a separate window Key Resources Table Glioblastoma expression subtypes have been related to genomic abnormalities, treatment response, and differences in tumor microenvironment. ..
DNA Library Preparation:Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
Transduction:Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
Plasmid Preparation:Article Title: Flura-seq identifies organ-specific metabolic adaptations during early metastatic colonization
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody anti-BrdU; BrdU antibody (Rat monoclonal) Abcam Cat#ab6326 (1:200) Antibody anti-CD31; CD31 antibody (Rat monoclonal) Dianova Cat#DIA-310 (1:100) Antibody anti-GFP; GFP antibody (Chicken monoclonal) Aves Labs Cat#GFP-1020 (1:500) Antibody anti-4-Hydroxynonenal; 4-HNE antibodyl (Rabbit polyclonal) Abcam Cat#ab46545 (1:75) Antibody anti-NRF2; NRF2 antibody (Rabbit polyclonal) Abcam Cat#ab137550 (1:600) Antibody anti-Glutathione Peroxidase 1; GPX1 antibody (Rabbit polyclonal) Abcam Cat#ab22604 (1:200) Antibody Goat polyclonal anti-chicken Thermo Fisher Cat#A-11039 (1:1000) Antibody Goat polyclonal anti-rat Thermo Fisher Cat#A-11006 (1:1000) Antibody Goat polyclonal anti-mouse Abcam Cat#ab150117 (1:1000) Biological sample (Human) Human breast cancer lung metastases tissue microarray (TMA) This paper (Section of lung tissue containing cancer cells was surgically removed from breast cancer patients, preserved in paraflim and a small portion of the preserved tumor was used to make the TMA) N/A Tissue microarray Available from Edi Brogi Chemical compound, drug Doxycycline Sigmal-Aldrich Cat#D9891 Chemical compound, drug 5-Fluorocytosine; 5-FC Sigma-Aldrich Cat#F7129 Chemical compound, drug 5-Fluorouracil; 5-FU Sigma-Aldrich Cat#F6627 Chemical compound, drug SB-505124 Sigma-Aldrich Cat#S4696 Chemical compound, drug Thymine Sigma-Aldrich Cat#T0376 Chemical compound, drug 4-Thiouracil; TU Sigma-Aldrich Cat#440736 Other Oligo (dT)25 magnetic beads New England Biolabs Cat#S1419S Other Protein G Dynabeads Thermo Fisher Scientific Cat#10004D Commercial assay or kit Tissue digestion C-tube Miltenyi Cat#130-096-334 Continued on next page Basnet et al. eLife 2019;8:e43627. .. DOI: https://doi.org/10.7554/eLife.43627 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Tumor Dissociation Kit Miltenyi Cat#130-096-730 Commercial assay or kit TruSeq RNA Library Prep Kit v2 Illumina RS-122–2001 Commercial assay or kit SMARTer PCR cDNA synthesis kit Clontech Cat634926 Commercial assay or kit Nextera XT DNA library Preparation Kit Illumina FC-131–1024 Commercial assay or kit RNeasy MinElute Cleanup kit Qiagen Cat#74204 Commercial assay or kit cDNA kit-First Strand Transcriptor Roche Cat#043790–12001 Cell line (Human) MDA231 Laboratory of Joan Massague PMID: 19421193 Expresses TGL Cell line (Human) MDA231-CD This paper (MDA231 cells were transduced with rtTA3 and TRE-CD-IRES-RFP) N/A Available from Massague lab Cell line (Human) MDA231-CD/UPRT This paper (MDA231 cells were transduced with rtTA3 and TRE-UPRT-T2A-RFP-IRES-CD) N/A Available from Massague lab Cell line (Human) 293T Laboratory of Joan Massague N/A Strain, strain background (Mus musculus) Hsd:Athymic Nude- Foxn1nu Envigo Cat#069 Sequence-based reagents Oligonucleotides This paper N/A Oligonucleotide sequences are provided in Supplementary file 6 Recombinant DNA reagent CMV Tight RFP-IRES-CD This paper (RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP). .. N/A Available from Massague lab Recombinant DNA reagent CMV Tight UPRTT2A-RFP-IRES-CD This paper (UPRT-T2A-RFP-IRES-CD was subcloned into CMV Tight EGFP Puro (Addgene: Plasmid #26431) vector by removing EGFP).
|
TaKaRa is a verified supplier 
TaKaRa manufactures this product 